SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach (Final Report)

2024-01-21

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach In the SyPro Poplar project, we aimed to integrate omics, bioinformatics, synthetic biology, and genetic engineering approaches to develop transgenic poplar trees with sustained photosynthetic activity and increased biomass production under individual and the simultaneous occurrence of water deficit, increased soil salinity, and elevated temperatures. Specifically, we intended to (i) study the functions of selected stress-responsive genes at tissue and cell type-specific levels, (ii) discover novel motifs and construct stress-responsive synthetic promoters, and (iii) use these promoters to drive the expression of genes shown to confer abiotic stress tolerance in a variety of crops and develop abiotic stress-tolerant poplars in a coordinated fashion.

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Plant Biotechnology Journal · 2024-01-17 · 14 citations

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

Frontiers in Plant Science · 2024-02-29 · 19 citations

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar ( Populus tremula× P. alba ) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

Salinity‐Induced Photorespiration in <i>Populus</i> Vascular Tissues Facilitate Nitrogen Reallocation

Plant Cell & Environment · 2024-10-01 · 3 citations

ABSTRACT Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. We used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell‐specific changes in proteins and metabolites were determined. Salinity induced a vascular‐specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3‐phosphoglycerate and NH 4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH 4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt‐induced photorespiration in vascular cells mediates N‐reallocation in Populus , an essential process for the adaptation of trees to adverse conditions.

Stress-induced endocytosis from chloroplast inner envelope membrane is mediated by CHLOROPLAST VESICULATION but inhibited by GAPC

Cell Reports · 2023-10-01 · 19 citations

Clathrin-mediated vesicular formation and trafficking are responsible for molecular cargo transport and signal transduction among organelles. Our previous study shows that CHLOROPLAST VESICULATION (CV)-containing vesicles (CVVs) are generated from chloroplasts for chloroplast degradation under abiotic stress. Here, we show that CV interacts with the clathrin heavy chain (CHC) and induces vesicle budding toward the cytosol from the chloroplast inner envelope membrane. In the defective mutants of CHC2 and the dynamin-encoding DRP1A, CVV budding and releasing from chloroplast are impeded. The mutations of CHC2 inhibit CV-induced chloroplast degradation and hypersensitivity to water stress. Moreover, CV-CHC2 interaction is impaired by the oxidized GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE (GAPC). GAPC1 overexpression suppresses CV-mediated chloroplast degradation and hypersensitivity to water stress, while CV silencing alleviates the hypersensitivity of the gapc1gapc2 plant to water stress. Together, our work identifies a pathway of clathrin-assisted CVV budding outward from chloroplast, which is involved in chloroplast degradation and stress response.

Welcoming new editors for Plant Science

Plant Science · 2023-01-02

Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation

BIO-PROTOCOL · 2023-01-01 · 7 citations

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

CRISPR/Cas9-mediated knockout of a polyester synthase-like gene delays flowering time in alfalfa

Plant Cell Reports · 2023-02-25 · 4 citations

The reference genome and abiotic stress responses of the model perennial grass <i>Brachypodium sylvaticum</i>

G3 Genes Genomes Genetics · 2023-10-26 · 7 citations

Perennial grasses are important forage crops and emerging biomass crops and have the potential to be more sustainable grain crops. However, most perennial grass crops are difficult experimental subjects due to their large size, difficult genetics, and/or their recalcitrance to transformation. Thus, a tractable model perennial grass could be used to rapidly make discoveries that can be translated to perennial grass crops. Brachypodium sylvaticum has the potential to serve as such a model because of its small size, rapid generation time, simple genetics, and transformability. Here, we provide a high-quality genome assembly and annotation for B. sylvaticum, an essential resource for a modern model system. In addition, we conducted transcriptomic studies under 4 abiotic stresses (water, heat, salt, and freezing). Our results indicate that crowns are more responsive to freezing than leaves which may help them overwinter. We observed extensive transcriptional responses with varying temporal dynamics to all abiotic stresses, including classic heat-responsive genes. These results can be used to form testable hypotheses about how perennial grasses respond to these stresses. Taken together, these results will allow B. sylvaticum to serve as a truly tractable perennial model system.